ID: 948735209_948735213

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 948735209 948735213
Species Human (GRCh38) Human (GRCh38)
Location 2:239999226-239999248 2:239999252-239999274
Sequence CCTGTTTCACGTAGGGATGCACG TCATTCTGGACAGGGAACAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24} {0: 1, 1: 0, 2: 2, 3: 14, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!