ID: 948753003_948753006

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 948753003 948753006
Species Human (GRCh38) Human (GRCh38)
Location 2:240143325-240143347 2:240143343-240143365
Sequence CCTGGGATTCTGCATCCCTAACC TAACCAGCTCCCAAGAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 105, 4: 519} {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!