ID: 948766934_948766944

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 948766934 948766944
Species Human (GRCh38) Human (GRCh38)
Location 2:240227227-240227249 2:240227249-240227271
Sequence CCAGCCCCTGAGGCCTCCAGTGC CAGGCTGCTGGGTAGGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!