ID: 948771038_948771045

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 948771038 948771045
Species Human (GRCh38) Human (GRCh38)
Location 2:240251394-240251416 2:240251407-240251429
Sequence CCAGCCTGCCACCCCCTCATCCC CCCTCATCCCACACAGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 128, 4: 1191} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!