ID: 948805622_948805630

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 948805622 948805630
Species Human (GRCh38) Human (GRCh38)
Location 2:240452556-240452578 2:240452587-240452609
Sequence CCGCTTAGCTGCAGTGGGGAGCC CCGGACTGCCCGCGGAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 181} {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!