ID: 948806574_948806583

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 948806574 948806583
Species Human (GRCh38) Human (GRCh38)
Location 2:240455789-240455811 2:240455822-240455844
Sequence CCGGCCTCTGCCATCTCATGTCC CCTGTGGCCCCGGCCTGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 512} {0: 1, 1: 0, 2: 1, 3: 25, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!