ID: 948811668_948811680

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 948811668 948811680
Species Human (GRCh38) Human (GRCh38)
Location 2:240481572-240481594 2:240481600-240481622
Sequence CCAGTCCCCTCTCCATCACCTCG TTGCTCAGGGTTTATGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 478} {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!