ID: 948817255_948817264

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 948817255 948817264
Species Human (GRCh38) Human (GRCh38)
Location 2:240518425-240518447 2:240518444-240518466
Sequence CCCTGCTATGAAACCCCCAATTT ATTTTAGTCGGTTGAGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 158} {0: 1, 1: 0, 2: 11, 3: 29, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!