ID: 948825330_948825349

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 948825330 948825349
Species Human (GRCh38) Human (GRCh38)
Location 2:240571090-240571112 2:240571143-240571165
Sequence CCAGCCCCCCCCAAGGGGGAGGC CTGAACACCCTGGCAGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 263} {0: 1, 1: 0, 2: 0, 3: 29, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!