ID: 948850676_948850685

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 948850676 948850685
Species Human (GRCh38) Human (GRCh38)
Location 2:240703914-240703936 2:240703937-240703959
Sequence CCTCAGCTTTCTCTGCCCCACCC AACCCTCAGCTCCCTGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 26, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!