ID: 948860782_948860785

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 948860782 948860785
Species Human (GRCh38) Human (GRCh38)
Location 2:240751717-240751739 2:240751730-240751752
Sequence CCTTGCAGGGGTGTCCATGCCCC TCCATGCCCCATGTGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 199} {0: 1, 1: 0, 2: 1, 3: 30, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!