ID: 948864997_948865006

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 948864997 948865006
Species Human (GRCh38) Human (GRCh38)
Location 2:240770759-240770781 2:240770779-240770801
Sequence CCCCCAAGTGAACTGGCTGCCTT CTTGGCTGCTGTGGGTGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 263} {0: 1, 1: 1, 2: 2, 3: 30, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!