ID: 948875331_948875335

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 948875331 948875335
Species Human (GRCh38) Human (GRCh38)
Location 2:240823925-240823947 2:240823949-240823971
Sequence CCTTGGGCGTCGAGTGACTCTGG CTGTGAGCGCCCAGTGGTGTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!