ID: 948884339_948884348

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 948884339 948884348
Species Human (GRCh38) Human (GRCh38)
Location 2:240875380-240875402 2:240875394-240875416
Sequence CCCCCATTCCTCGACTGGCCCGA CTGGCCCGAGGCTCTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 233} {0: 1, 1: 1, 2: 2, 3: 39, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!