ID: 948904776_948904781

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 948904776 948904781
Species Human (GRCh38) Human (GRCh38)
Location 2:240973591-240973613 2:240973622-240973644
Sequence CCCGCCTGTGGGGGCTCAACTCA CACAGGTTCTAAAAGTTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 104} {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!