ID: 948924810_948924819

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 948924810 948924819
Species Human (GRCh38) Human (GRCh38)
Location 2:241088686-241088708 2:241088707-241088729
Sequence CCAAGAAACCCCTAGATCAGCTG TGCAGTGGGAGGAAGAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126} {0: 1, 1: 1, 2: 12, 3: 96, 4: 1002}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!