ID: 948953200_948953209

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 948953200 948953209
Species Human (GRCh38) Human (GRCh38)
Location 2:241268508-241268530 2:241268534-241268556
Sequence CCTGAGGCCGCCTCTGTCAGCCT AGCTTTTGCTGGTATGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 230} {0: 1, 1: 0, 2: 3, 3: 9, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!