ID: 948953431_948953436

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 948953431 948953436
Species Human (GRCh38) Human (GRCh38)
Location 2:241270183-241270205 2:241270213-241270235
Sequence CCCTATACTGAAAGGAGTCTCAA GAACCTACTCCTGTGTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 121} {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!