ID: 948953967_948953975

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 948953967 948953975
Species Human (GRCh38) Human (GRCh38)
Location 2:241272805-241272827 2:241272832-241272854
Sequence CCCGCGCGGGAGAAGCCGGGACG GAGGCGCGGCGCCCGGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 4, 3: 97, 4: 719}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!