ID: 948960064_948960069

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 948960064 948960069
Species Human (GRCh38) Human (GRCh38)
Location 2:241327927-241327949 2:241327966-241327988
Sequence CCGGTAGTCACAGCTACTTGAGA TCACCTCAGCCTGAGACGTCAGG
Strand - +
Off-target summary {0: 31, 1: 2510, 2: 53653, 3: 175471, 4: 235980} {0: 1, 1: 0, 2: 0, 3: 34, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!