ID: 948974291_948974292

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948974291 948974292
Species Human (GRCh38) Human (GRCh38)
Location 2:241454042-241454064 2:241454059-241454081
Sequence CCAAAGTGTTGGGATTATAGCCA TAGCCATGAGTCACCGCACCCGG
Strand - +
Off-target summary {0: 12, 1: 1235, 2: 22329, 3: 141944, 4: 264531} {0: 1, 1: 20, 2: 887, 3: 10420, 4: 48694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!