ID: 948981138_948981143

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 948981138 948981143
Species Human (GRCh38) Human (GRCh38)
Location 2:241495466-241495488 2:241495480-241495502
Sequence CCTGACGTGCACAACAGCACACT CAGCACACTGCAGGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135} {0: 1, 1: 0, 2: 3, 3: 65, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!