ID: 948983488_948983495

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 948983488 948983495
Species Human (GRCh38) Human (GRCh38)
Location 2:241507043-241507065 2:241507075-241507097
Sequence CCTGTTCCACTGCAGGCCCAACT GCACATAGGAGTGAACAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163} {0: 1, 1: 0, 2: 2, 3: 11, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!