ID: 948999916_948999925

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 948999916 948999925
Species Human (GRCh38) Human (GRCh38)
Location 2:241607350-241607372 2:241607378-241607400
Sequence CCCTCACCCTGGCTGGATGCACG TGCTCTTACTCATTTTCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149} {0: 1, 1: 0, 2: 1, 3: 32, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!