ID: 949022679_949022702

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 949022679 949022702
Species Human (GRCh38) Human (GRCh38)
Location 2:241750335-241750357 2:241750387-241750409
Sequence CCTTCTGCACGTCTGGACACATG GGGTGCCCGGGCGGGCGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 112} {0: 1, 1: 0, 2: 3, 3: 48, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!