ID: 949022707_949022712

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 949022707 949022712
Species Human (GRCh38) Human (GRCh38)
Location 2:241750393-241750415 2:241750413-241750435
Sequence CCGGGCGGGCGGGTGGGGGGTCC TCCCTGGGCGGAGCATGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 522} {0: 1, 1: 0, 2: 2, 3: 25, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!