ID: 949032318_949032328

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 949032318 949032328
Species Human (GRCh38) Human (GRCh38)
Location 2:241802919-241802941 2:241802951-241802973
Sequence CCTGTGGGCAGCTGGTGGAGTGC CTGTGCCAGGGGCCCGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 180} {0: 1, 1: 0, 2: 1, 3: 26, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!