ID: 949035692_949035707

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 949035692 949035707
Species Human (GRCh38) Human (GRCh38)
Location 2:241814844-241814866 2:241814893-241814915
Sequence CCCAGGTCCCTGGACGTCCTGGT GGGGTGCCCTGCACGTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 141} {0: 1, 1: 0, 2: 2, 3: 16, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!