ID: 949046323_949046338

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 949046323 949046338
Species Human (GRCh38) Human (GRCh38)
Location 2:241874132-241874154 2:241874177-241874199
Sequence CCTCTTCCCTCCAGCCTCAGTGT CCTCTCATCCAGAGGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 795, 4: 11222} {0: 1, 1: 0, 2: 1, 3: 18, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!