ID: 949046579_949046590

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 949046579 949046590
Species Human (GRCh38) Human (GRCh38)
Location 2:241875020-241875042 2:241875041-241875063
Sequence CCAGGGGAAACCCCAATCCAGGG GGCCTCGGGGGCCAACTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 3, 3: 17, 4: 206} {0: 2, 1: 1, 2: 3, 3: 25, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!