ID: 949046919_949046932

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 949046919 949046932
Species Human (GRCh38) Human (GRCh38)
Location 2:241876630-241876652 2:241876668-241876690
Sequence CCCAGGGGCCGAAATGCAGGGAC AACCCCAATCCAGGGCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!