ID: 949048064_949048074

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 949048064 949048074
Species Human (GRCh38) Human (GRCh38)
Location 2:241881383-241881405 2:241881425-241881447
Sequence CCTCAGTGACGCGGGGCACAGCT AGCCCACCTGGACCCCACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 52, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!