ID: 949048077_949048091

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 949048077 949048091
Species Human (GRCh38) Human (GRCh38)
Location 2:241881428-241881450 2:241881466-241881488
Sequence CCACCTGGACCCCACACTGGGTC GAGGCCGCTGTAGGTGGGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!