ID: 949048082_949048097

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 949048082 949048097
Species Human (GRCh38) Human (GRCh38)
Location 2:241881439-241881461 2:241881485-241881507
Sequence CCACACTGGGTCAGCCCTGGTGC ACGGGGCAGCACGCGTTAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!