ID: 949058556_949058560

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 949058556 949058560
Species Human (GRCh38) Human (GRCh38)
Location 2:241943288-241943310 2:241943310-241943332
Sequence CCCTCTGCAGTCCCTTTCTGCAG GACTCTCTTCCGTGTCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 41, 4: 315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!