ID: 949070474_949070478 |
View in Genome Browser |
Spacer: 6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 949070474 | 949070478 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:242021350-242021372 | 2:242021379-242021401 |
| Sequence | CCTGTTTGAGGGCTGGGAAGCTG | TGGTTTGAGGGCCGTGCAGCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 1, 2: 59, 3: 160, 4: 315} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||