ID: 949079875_949079895

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 949079875 949079895
Species Human (GRCh38) Human (GRCh38)
Location 2:242088475-242088497 2:242088512-242088534
Sequence CCCGCGCCCCCGCGCCCCCGCGC ACCTCCACGCCCGGCACTCTGGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 31, 3: 276, 4: 1575} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!