ID: 949093262_949093265

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 949093262 949093265
Species Human (GRCh38) Human (GRCh38)
Location 3:54812-54834 3:54833-54855
Sequence CCTAGATTAAGGCATGTGTTGCA CAGGATTAGGTCATAGAGACAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 18, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!