ID: 949102541_949102553

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 949102541 949102553
Species Human (GRCh38) Human (GRCh38)
Location 3:163459-163481 3:163504-163526
Sequence CCCTCCTCCATCTTCTTCTCCTT TGTTGCTCTGTTGCCGAGGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 441, 2: 24040, 3: 75277, 4: 174313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!