ID: 949102543_949102547

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 949102543 949102547
Species Human (GRCh38) Human (GRCh38)
Location 3:163463-163485 3:163481-163503
Sequence CCTCCATCTTCTTCTCCTTCTCC TCTCCTTCTTCTTCCTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 24, 2: 220, 3: 1380, 4: 6153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!