ID: 949118270_949118276

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 949118270 949118276
Species Human (GRCh38) Human (GRCh38)
Location 3:355462-355484 3:355496-355518
Sequence CCCCAAATCTTCCACTGGAACCT TATTTTGGATGTCCTTGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177} {0: 1, 1: 0, 2: 1, 3: 17, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!