ID: 949278332_949278334

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 949278332 949278334
Species Human (GRCh38) Human (GRCh38)
Location 3:2315358-2315380 3:2315373-2315395
Sequence CCAACATGTATTCATCAGTTTCC CAGTTTCCCAAACGAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 299} {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!