|
Left Crispr |
Right Crispr |
| Crispr ID |
949312807 |
949312817 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:2719408-2719430
|
3:2719457-2719479
|
| Sequence |
CCTCAGCCTCCCAAGTAGCTGGG |
GCTGATTTTTTAGCAGAGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 89011, 1: 200457, 2: 243521, 3: 257984, 4: 301655} |
{0: 1, 1: 5, 2: 71, 3: 468, 4: 10636} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|