|
Left Crispr |
Right Crispr |
Crispr ID |
949312811 |
949312817 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:2719417-2719439
|
3:2719457-2719479
|
Sequence |
CCCAAGTAGCTGGGACTGCAGGA |
GCTGATTTTTTAGCAGAGACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 45, 1: 2607, 2: 55121, 3: 218673, 4: 282661} |
{0: 1, 1: 5, 2: 71, 3: 468, 4: 10636} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|