ID: 949319464_949319471

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 949319464 949319471
Species Human (GRCh38) Human (GRCh38)
Location 3:2792744-2792766 3:2792783-2792805
Sequence CCCTTGTGAGAGAGAATAGGGTG AGTTTAGGCTGTTTTGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 195} {0: 1, 1: 1, 2: 2, 3: 18, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!