ID: 949324231_949324238

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 949324231 949324238
Species Human (GRCh38) Human (GRCh38)
Location 3:2845985-2846007 3:2846016-2846038
Sequence CCATTTTTGTCTTCAGTAATCAA CCTTAAGAAGGTGTGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 436} {0: 1, 1: 0, 2: 2, 3: 38, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!