ID: 949339483_949339489

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 949339483 949339489
Species Human (GRCh38) Human (GRCh38)
Location 3:3013423-3013445 3:3013472-3013494
Sequence CCAGCAACTATTTCTGAGATGAG AACGGAGTCCTGCTTATTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!