ID: 949414304_949414311

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 949414304 949414311
Species Human (GRCh38) Human (GRCh38)
Location 3:3799546-3799568 3:3799567-3799589
Sequence CCCGGGCGGCGGCATCCCTAGGC GCGCCTGGGGCGCCTTCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96} {0: 1, 1: 0, 2: 6, 3: 15, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!