|
Left Crispr |
Right Crispr |
| Crispr ID |
949463254 |
949463259 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:4317052-4317074
|
3:4317099-4317121
|
| Sequence |
CCAACCAACTACCACGTCTTTAA |
AAAACGCTTCCACAACCAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 31, 3: 74, 4: 169} |
{0: 18, 1: 87, 2: 83, 3: 50, 4: 95} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|