ID: 949482950_949482956

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 949482950 949482956
Species Human (GRCh38) Human (GRCh38)
Location 3:4511306-4511328 3:4511334-4511356
Sequence CCTTTTTTTTTACGCACAGCTCA CAATTTCAATAGAGGGCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 268} {0: 1, 1: 0, 2: 0, 3: 37, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!